Alternative yeast nuclear code

 The alternative yeast nuclear code (translation table 12) is a genetic code found in certain yeasts. However, other yeast, including Saccharomyces cerevisiae, Candida azyma, Candida diversa, Candida magnoliae, Candida rugopelliculosa, Yarrowia lipolytica, and Zygoascus hellenicus, definitely use the standard (nuclear) code.^[1]

The codeEdit

   AAs = FFLLSSSSYY**CC*WLLLSPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG

Starts = -------------------M---------------M----------------------------

 Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG

 Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG

 Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V).

Differences from the standard codeEdit

DNA codons	RNA codons	This code (12)		Standard code (1)
CTG	CUG	Ser (S)		Leu (L)

Alternative initiation codonsEdit

• CAG may be used in Candida albicans.^[2]

Systematic rangeEdit

• Endomycetales (yeasts): Candida albicans, Candida cylindracea, Candida melibiosica, Candida parapsilosis, and Candida rugosa.^[1]

This article uses material from the Wikipedia article  Metasyntactic variable, which is released under the  Creative Commons Attribution-ShareAlike 3.0 Unported License.