Blastocrithidia nuclear code

 The Blastocrithidia nuclear code (translation table 31) is a genetic code used by the nuclear genome of the trypanosomatid genus Blastocrithidia.[1]

The code (31)Edit

   AAs = FFLLSSSSYYEECCWWLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG
Starts = ----------**-----------------------M----------------------------
 Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG
 Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG
 Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (Val, V).

Differences from the standard codeEdit

DNA codonsRNA codonsThis code (31)Standard code (1)
TAAUAATer (*)orGlu (E)Ter (*)
TAGUAGTer (*)orGlu (E)Ter (*)
TGAUGATrp (W)Ter (*)

This article uses material from the Wikipedia article
 Metasyntactic variable, which is released under the 
Creative Commons
Attribution-ShareAlike 3.0 Unported License
.