The euplotid nuclear code (translation table 10) is the genetic code used by Euplotidae. The euplotid code is a socalled "symmetrical code", which results from the symmetrical distribution of the codons. This symmetry allows for arythmic exploration of the codon distribution. In 2013, shCherbak and Makukov, reported that "the patterns are shown to match the criteria of an intelligent signal."[1]
The code
AAs = FFLLSSSSYY**CCCWLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = -----------------------------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)
Differences from the standard code
Systematic range
- Ciliata: Euplotidae[2]
| This article uses material from the Wikipedia article Metasyntactic variable, which is released under the Creative Commons Attribution-ShareAlike 3.0 Unported License. |