Euplotid nuclear code

 The euplotid nuclear code (translation table 10) is the genetic code used by Euplotidae. The euplotid code is a socalled "symmetrical code", which results from the symmetrical distribution of the codons. This symmetry allows for arythmic exploration of the codon distribution. In 2013, shCherbak and Makukov, reported that "the patterns are shown to match the criteria of an intelligent signal."[1]

The codeEdit

   AAs = FFLLSSSSYY**CCCWLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG
Starts = -----------------------------------M----------------------------
 Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG
 Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG
 Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)

Differences from the standard codeEdit

DNA codonsRNA codonsThis code (10)Standard code (1)
TGAUGACys (C)STOP = Ter (*)

Systematic rangeEdit

  • CiliataEuplotidae[2]

This article uses material from the Wikipedia article
 Metasyntactic variable, which is released under the 
Creative Commons
Attribution-ShareAlike 3.0 Unported License
.