Karyorelict nuclear code

 The karyorelictid nuclear code (translation table 27) is a genetic code used by the nuclear genome of the Karyorelictea ciliate Parduczia sp.^[1]

The code (27)Edit

   AAs = FFLLSSSSYYQQCCWWLLLAPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG

Starts = --------------*--------------------M----------------------------

 Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG

 Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG

 Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (Val, V).

Differences from the standard codeEdit

DNA codons	RNA codons	This code (27)				Standard code (1)
TAA	UAA	Gln (Q)				Ter (*)
TAG	UAG	Gln (Q)				Ter (*)
TGA	UGA	Ter (*)	or	Trp (W)		Ter (*)

This article uses material from the Wikipedia article  Metasyntactic variable, which is released under the  Creative Commons Attribution-ShareAlike 3.0 Unported License.