Mesodinium nuclear code

 The Mesodinium nuclear code (translation table 29) is a genetic code used by the nuclear genome of the ciliates Mesodinium and Myrionecta.^[1]

The code (29)Edit

   AAs = FFLLSSSSYYYYCC*WLLLAPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG

Starts = --------------*--------------------M----------------------------

 Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG

 Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG

 Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (Val, V).

Differences from the standard codeEdit

DNA codons	RNA codons	This code (29)		Standard code (1)
TAA	UAA	Tyr (Y)		Ter (*)
TAG	UAG	Tyr (Y)		Ter (*)

This article uses material from the Wikipedia article  Metasyntactic variable, which is released under the  Creative Commons Attribution-ShareAlike 3.0 Unported License.