Pachysolen tannophilus nuclear code

 The pachysolen tannophilus nuclear code (translation table 26) is a genetic code found in the ascomycete fungus Pachysolen tannophilus.^[1]

CodeEdit

   AAs = FFLLSSSSYY**CC*WLLLAPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG

Starts = -------------------M---------------M----------------------------

 Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG

 Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG

 Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)

Differences from the standard codeEdit

DNA codons	RNA codons	This code (26)		Standard code (1)
CTG	CUG	Ala (A)		Leu (L)

Initiation codonsEdit

This code uses the initiation codons AUG, GUG and UUG.

Systematic range and commentsEdit

• Pachysolen tannophilus

This article uses material from the Wikipedia article  Metasyntactic variable, which is released under the  Creative Commons Attribution-ShareAlike 3.0 Unported License.