The echinoderm and flatworm mitochondrial code (translation table 9) is a genetic code used by the mitochondria of certain echinoderm and flatworm species.[1] The code Edit AAs = FFLLSSSSYY**CCWWLLLLPPPPHHQQRRRRIIIMTTTTNNNKSSSSVVVVAAAADDEEGGGG Starts = -----------------------------------M---------------M------------ Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U). Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V) Differences from the standard code Edit DNA codons RNA codons This code (9) Standard code (1) AAA AAA Asn (N) Lys (K) AGA AGA Ser (S) Arg (R) AGG AGG Ser (S) Arg (R) TGA UGA Trp (W) STOP = Ter (*) Systematic range Edit Asterozoa (starfishes) [2] Echinozoa (sea urchins) [3][4] Rhabditophora among the Platyhelminthes[5]

The echinoderm and flatworm mitochondrial code (translation table 9) is a genetic code used by the mitochondria of certain echinoderm and flatworm species.^[1]

The codeEdit

AAs = FFLLSSSSYY**CCWWLLLLPPPPHHQQRRRRIIIMTTTTNNNKSSSSVVVVAAAADDEEGGGG

Starts = -----------------------------------M---------------M------------

Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG

Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG

Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)

Differences from the standard codeEdit


DNA codons	RNA codons	This code (9)	Standard code (1)
AAA	AAA	Asn (N)	Lys (K)
AGA	AGA	Ser (S)	Arg (R)
AGG	AGG	Ser (S)	Arg (R)
TGA	UGA	Trp (W)	STOP = Ter (*)

Systematic rangeEdit

Asterozoa (starfishes) ^[2]
Echinozoa (sea urchins) ^[3]^[4]
Rhabditophora among the Platyhelminthes^[5]