Thraustochytrium mitochondrial code

 The Thraustochytrium mitochondrial code (translation table 23) is a genetic code found in the mitochondria of labyrinthulid Thraustochytrium aureum.^[1] The mitochondrial genome was sequenced by the Organelle Genome Megasequencing Program.

CodeEdit

   AAs = FF*LSSSSYY**CC*WLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG

Starts = --------------------------------M--M---------------M------------

 Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG

 Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG

 Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)

Differences from the standard codeEdit

It is the similar to the bacterial code (translation table 11) but it contains an additional stop codon (TTA) and also has a different set of start codons.

DNA codons	RNA codons	This code (23)		Standard code (1)
TTA	UUA	STOP = Ter (*)		Leu (L)

Systematic range and commentsEdit

• Mitochondria of Thraustochytrium aureum.

This article uses material from the Wikipedia article  Metasyntactic variable, which is released under the  Creative Commons Attribution-ShareAlike 3.0 Unported License.